Cherry SNP DataBase

SNP information

Name Pav_sc0000764.1_216338R
Chr PAV_r1.0chr1
Pos (Chr) 5871055
PAV_r1.0 Pav_sc0000764.1
Pos (PAV_r1.0) 216338
REF A
ALT G
SSR motif
Gene Name Pav_sc0000764.1_g380.1.mk
Annotation PREDICTED: cinnamoyl-CoA reductase 2-like isoform X2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.516+37A>G
Amino Acid
PCR Forward primer TTGACTGCAGCAATTTGGAG
Reverse primer CCACCTAGCCATGTCCCTAA
Product size 286
Enzymes for CAPS AluI
Exp. fragment size (REF) 131,110,45
Exp. fragment size (ALT) 241,45
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT ALT/ALT ALT/ALT REF/ALT ALT/ALT REF/ALT


| Top |