Cherry SNP DataBase

SNP information

Name Pav_sc0000773.1_108084R
Chr PAV_r1.0chr2
Pos (Chr) 5979312
PAV_r1.0 Pav_sc0000773.1
Pos (PAV_r1.0) 108084
REF G
ALT A
SSR motif
Gene Name Pav_sc0000773.1_g120.1.mk
Annotation PREDICTED: sister chromatid cohesion 1 protein 3
snpEff Effect synonymous_variant
Impact LOW
Codon c.825C>T
Amino Acid p.Asp275Asp
PCR Forward primer CACTTCCTCAAAGAAAGGCG
Reverse primer AAGACGAAGGTCGAAGGATG
Product size 290
Enzymes for CAPS EcoRV
Exp. fragment size (REF) 290
Exp. fragment size (ALT) 165,125
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |