Cherry SNP DataBase

SNP information

Name Pav_sc0000789.1_141688Y
Chr PAV_r1.0chr2
Pos (Chr) 19240287
PAV_r1.0 Pav_sc0000789.1
Pos (PAV_r1.0) 141688
REF C
ALT T
SSR motif
Gene Name Pav_sc0000789.1_g290.1.mk
Annotation PREDICTED: adenylate kinase-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.*98-13462C>T
Amino Acid
PCR Forward primer AAGCAATTCTCCAGCCTTCA
Reverse primer TGGTCACTACGACCATTGGA
Product size 349
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |