Cherry SNP DataBase

SNP information

Name Pav_sc0000789.1_206705Y
Chr PAV_r1.0chr2
Pos (Chr) 19305304
PAV_r1.0 Pav_sc0000789.1
Pos (PAV_r1.0) 206705
REF T
ALT C
SSR motif
Gene Name Pav_sc0000789.1_g380.1.mk
Annotation PREDICTED: macrophage erythroblast attacher isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.498+118T>C
Amino Acid
PCR Forward primer GGAGATGTCCGCCGTTATTA
Reverse primer CTCAAGCTCACTCATTGCCA
Product size 329
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT REF/ALT


| Top |