Cherry SNP DataBase

SNP information

Name Pav_sc0000789.1_24066K
Chr PAV_r1.0chr2
Pos (Chr) 19122665
PAV_r1.0 Pav_sc0000789.1
Pos (PAV_r1.0) 24066
REF G
ALT T
SSR motif
Gene Name Pav_sc0000789.1_g070.1.mk
Annotation PREDICTED: uncharacterized protein LOC103332415
snpEff Effect missense_variant
Impact MODERATE
Codon c.632C>A
Amino Acid p.Ala211Asp
PCR Forward primer CCGACTTCGTTTCTTGTTCC
Reverse primer TTGAGGAAGCTGAGGTGGTT
Product size 225
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |