Cherry SNP DataBase

SNP information

Name Pav_sc0000789.1_94200K
Chr PAV_r1.0chr2
Pos (Chr) 19192799
PAV_r1.0 Pav_sc0000789.1
Pos (PAV_r1.0) 94200
REF G
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.94200G>T
Amino Acid
PCR Forward primer TGATCTCCTCCTGCAGACCT
Reverse primer CAAGCAAACAAGGCAAGTCA
Product size 221
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT


| Top |