Cherry SNP DataBase

SNP information

Name Pav_sc0000793.1_124772Y
Chr PAV_r1.0chr2
Pos (Chr) 2148195
PAV_r1.0 Pav_sc0000793.1
Pos (PAV_r1.0) 124772
REF T
ALT C
SSR motif
Gene Name Pav_sc0000793.1_g190.1.br
Annotation PREDICTED: zinc finger MYM-type protein 1-like
snpEff Effect stop_retained_variant
Impact LOW
Codon c.503A>G
Amino Acid p.Ter168Ter
PCR Forward primer GCTTTTCGGATTTGTTCTCG
Reverse primer CACCCAAATTCATCAAACCC
Product size 327
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/ALT ALT/ALT -/- REF/ALT


| Top |