Cherry SNP DataBase

SNP information

Name Pav_sc0000793.1_73628Y
Chr PAV_r1.0chr2
Pos (Chr) 2097051
PAV_r1.0 Pav_sc0000793.1
Pos (PAV_r1.0) 73628
REF C
ALT T
SSR motif
Gene Name Pav_sc0000793.1_g130.1.mk
Annotation hypothetical protein CICLE_v10001569mg
snpEff Effect synonymous_variant
Impact LOW
Codon c.240C>T
Amino Acid p.Thr80Thr
PCR Forward primer TCTGTTGGGAAGTGGGTAGG
Reverse primer TGCAAAATTCGGGTAAAACC
Product size 233
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |