Cherry SNP DataBase

SNP information

Name Pav_sc0000793.1_85057Y
Chr PAV_r1.0chr2
Pos (Chr) 2108480
PAV_r1.0 Pav_sc0000793.1
Pos (PAV_r1.0) 85057
REF T
ALT C
SSR motif
Gene Name Pav_sc0000793.1_g140.1.mk
Annotation PREDICTED: LOW QUALITY PROTEIN: lon protease homolog 1, mitochondrial-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1214+308A>G
Amino Acid
PCR Forward primer TATTCAAAAGCCTCAACGCC
Reverse primer TGTTGCCACACGTGATTTTT
Product size 232
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |