Cherry SNP DataBase

SNP information

Name Pav_sc0000800.1_51817M
Chr PAV_r1.0chr1
Pos (Chr) 32616481
PAV_r1.0 Pav_sc0000800.1
Pos (PAV_r1.0) 51817
REF C
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.51817C>A
Amino Acid
PCR Forward primer GCATCACTTGTCATGTCACTCA
Reverse primer TCGTTTCATTGGTTCCACAA
Product size 267
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT ALT/ALT REF/ALT REF/REF REF/REF REF/ALT


| Top |