Cherry SNP DataBase

SNP information

Name Pav_sc0000813.1_222846Y
Chr PAV_r1.0chr7
Pos (Chr) 14576593
PAV_r1.0 Pav_sc0000813.1
Pos (PAV_r1.0) 222846
REF C
ALT T
SSR motif
Gene Name Pav_sc0000813.1_g460.1.mk
Annotation PREDICTED: rab proteins geranylgeranyltransferase component A 2
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*325C>T
Amino Acid
PCR Forward primer TTGCACTGTTGGTGATGGTT
Reverse primer CTTTCATCCATAGTGCCCGT
Product size 257
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |