Cherry SNP DataBase

SNP information

Name Pav_sc0000823.1_375089M
Chr PAV_r1.0chr4
Pos (Chr) 7435487
PAV_r1.0 Pav_sc0000823.1
Pos (PAV_r1.0) 375089
REF C
ALT A
SSR motif
Gene Name Pav_sc0000823.1_g620.1.mk
Annotation PREDICTED: transcription initiation factor TFIID subunit 8-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.739-414C>A
Amino Acid
PCR Forward primer CGTCCCAGGATTCGATTTTA
Reverse primer TCTTGAAGTGCGTTGCTCAT
Product size 209
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT ALT/ALT REF/ALT REF/ALT REF/REF ALT/ALT REF/ALT


| Top |