Cherry SNP DataBase

SNP information

Name Pav_sc0000825.1_88547Y
Chr PAV_r1.0chr7
Pos (Chr) 7429119
PAV_r1.0 Pav_sc0000825.1
Pos (PAV_r1.0) 88547
REF T
ALT C
SSR motif
Gene Name Pav_sc0000825.1_g210.1.mk
Annotation hypothetical protein B456_004G071800
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*1448A>G
Amino Acid
PCR Forward primer CCAGCAAGGAGGGTTTACAA
Reverse primer GGAGCTGTCTGAGTTCGAGG
Product size 336
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |