Cherry SNP DataBase

SNP information

Name Pav_sc0000832.1_375140K
Chr PAV_r1.0chr3
Pos (Chr) 20658993
PAV_r1.0 Pav_sc0000832.1
Pos (PAV_r1.0) 375140
REF G
ALT T
SSR motif
Gene Name Pav_sc0000832.1_g650.1.mk
Annotation PREDICTED: phospholipid-transporting ATPase 2
snpEff Effect synonymous_variant
Impact LOW
Codon c.1422C>A
Amino Acid p.Val474Val
PCR Forward primer ACTCCAGAATTTCCAGGGCT
Reverse primer TGTACAAGGCGCAATCTCAA
Product size 224
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |