Cherry SNP DataBase

SNP information

Name Pav_sc0000845.1_79837K
Chr PAV_r1.0chr8
Pos (Chr) 14489334
PAV_r1.0 Pav_sc0000845.1
Pos (PAV_r1.0) 79837
REF T
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.79837T>G
Amino Acid
PCR Forward primer GCATAGGGCAGATGGGTAAA
Reverse primer TAAGGTGGGGACGTTCCTTT
Product size 339
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |