Cherry SNP DataBase

SNP information

Name Pav_sc0000848.1_465959Y
Chr PAV_r1.0chr8
Pos (Chr) 20125631
PAV_r1.0 Pav_sc0000848.1
Pos (PAV_r1.0) 465959
REF C
ALT T
SSR motif
Gene Name Pav_sc0000848.1_g950.1.mk
Annotation PREDICTED: uncharacterized protein LOC103934131 isoform X3
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1163-152C>T
Amino Acid
PCR Forward primer TTTTGATTGCTTCCACCCAC
Reverse primer ACACCAGGCAGGAGAAGAGA
Product size 316
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT ALT/ALT REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT


| Top |