Cherry SNP DataBase

SNP information

Name Pav_sc0000852.1_317061Y
Chr PAV_r1.0chr1
Pos (Chr) 32018473
PAV_r1.0 Pav_sc0000852.1
Pos (PAV_r1.0) 317061
REF T
ALT C
SSR motif
Gene Name Pav_sc0000852.1_g510.1.mk
Annotation PREDICTED: long chain base biosynthesis protein 1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1431+545T>C
Amino Acid
PCR Forward primer CCCTTTTAGTGGGAATGAAGG
Reverse primer GGCCTTTTGCTTGGTTTGTA
Product size 322
Enzymes for CAPS HhaI
Exp. fragment size (REF) 322
Exp. fragment size (ALT) 193,129
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT -/- -/- ALT/ALT REF/REF


| Top |