Cherry SNP DataBase

SNP information

Name Pav_sc0000869.1_227466R
Chr PAV_r1.0chr5
Pos (Chr) 8982990
PAV_r1.0 Pav_sc0000869.1
Pos (PAV_r1.0) 227466
REF G
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.227466G>A
Amino Acid
PCR Forward primer GTGAGTTTGGCCTGACCATT
Reverse primer AAATCCGTGGACACTAGGGA
Product size 338
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT


| Top |