Cherry SNP DataBase

SNP information

Name Pav_sc0000869.1_238745M
Chr PAV_r1.0chr5
Pos (Chr) 8971711
PAV_r1.0 Pav_sc0000869.1
Pos (PAV_r1.0) 238745
REF A
ALT C
SSR motif
Gene Name Pav_sc0000869.1_g550.1.br
Annotation PREDICTED: uncharacterized protein LOC103337625
snpEff Effect missense_variant
Impact MODERATE
Codon c.419A>C
Amino Acid p.Asn140Thr
PCR Forward primer GAGCTTCGAATCTGTCCAGG
Reverse primer CAATCTGCCTACGCTGTTGA
Product size 292
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT ALT/ALT REF/ALT REF/ALT REF/REF REF/ALT REF/ALT


| Top |