Cherry SNP DataBase

SNP information

Name Pav_sc0000882.1_163179R
Chr PAV_r1.0chr2
Pos (Chr) 5278819
PAV_r1.0 Pav_sc0000882.1
Pos (PAV_r1.0) 163179
REF A
ALT G
SSR motif
Gene Name Pav_sc0000882.1_g300.1.mk
Annotation PREDICTED: polygalacturonase
snpEff Effect intron_variant
Impact MODIFIER
Codon c.2554-22A>G
Amino Acid
PCR Forward primer CTCGCTTATGTCAAAACGCA
Reverse primer CCTCCCCCTATGGCTTAGTC
Product size 308
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF REF/REF REF/ALT


| Top |