Cherry SNP DataBase

SNP information

Name Pav_sc0000884.1_72994R
Chr PAV_r1.0chr4
Pos (Chr) 10372197
PAV_r1.0 Pav_sc0000884.1
Pos (PAV_r1.0) 72994
REF G
ALT A
SSR motif
Gene Name Pav_sc0000884.1_g260.1.mk
Annotation PREDICTED: nucleolar complex protein 3 homolog
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1107+45C>T
Amino Acid
PCR Forward primer CGACCTGAATGTTTTGCTCA
Reverse primer TCATTTCAGCATGTGGCATT
Product size 322
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |