Cherry SNP DataBase

SNP information

Name Pav_sc0000888.1_67702M
Chr PAV_r1.0chr4
Pos (Chr) 26655332
PAV_r1.0 Pav_sc0000888.1
Pos (PAV_r1.0) 67702
REF C
ALT A
SSR motif
Gene Name Pav_sc0000888.1_g080.1.mk
Annotation PREDICTED: filament-like plant protein
snpEff Effect splice_region_variant&intron_variant
Impact LOW
Codon c.-116+3G>T
Amino Acid
PCR Forward primer AAGGACTGAGCCAGGACAGA
Reverse primer GTCCTTTTCGCGTTCACAGT
Product size 245
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |