Cherry SNP DataBase

SNP information

Name Pav_sc0000890.1_445447R
Chr PAV_r1.0chr1
Pos (Chr) 29425834
PAV_r1.0 Pav_sc0000890.1
Pos (PAV_r1.0) 445447
REF A
ALT G
SSR motif
Gene Name Pav_sc0000890.1_g860.1.mk
Annotation PREDICTED: uncharacterized protein LOC103320920
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1157+1689T>C
Amino Acid
PCR Forward primer TGTTGTGTTTGTGTGCATGG
Reverse primer CCCTCCTTCTTTGTCATGGA
Product size 278
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |