Cherry SNP DataBase

SNP information

Name Pav_sc0000909.1_290908R
Chr PAV_r1.0chr6
Pos (Chr) 4129027
PAV_r1.0 Pav_sc0000909.1
Pos (PAV_r1.0) 290908
REF A
ALT G
SSR motif
Gene Name Pav_sc0000909.1_g420.1.br
Annotation PREDICTED: zinc finger MYM-type protein 1-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.324+921A>G
Amino Acid
PCR Forward primer TTCACTGTACCAGTTGGGCA
Reverse primer ATTTGAGCTGCAGGAGGATG
Product size 313
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |