Cherry SNP DataBase

SNP information

Name Pav_sc0000909.1_352801R
Chr PAV_r1.0chr6
Pos (Chr) 4190920
PAV_r1.0 Pav_sc0000909.1
Pos (PAV_r1.0) 352801
REF A
ALT G
SSR motif
Gene Name Pav_sc0000909.1_g530.1.mk
Annotation PREDICTED: protein YLS3-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.641-44A>G
Amino Acid
PCR Forward primer CAAACTCTCCGGACGCTAAG
Reverse primer AGGCTAAGCTCCCAAAAAGC
Product size 333
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |