Cherry SNP DataBase

SNP information

Name Pav_sc0000941.1_24193R
Chr PAV_r1.0chr3
Pos (Chr) 10574445
PAV_r1.0 Pav_sc0000941.1
Pos (PAV_r1.0) 24193
REF A
ALT G
SSR motif
Gene Name Pav_sc0000941.1_g050.1.mk
Annotation structural maintenance of chromosomes protein 2, partial
snpEff Effect missense_variant
Impact MODERATE
Codon c.328A>G
Amino Acid p.Ser110Gly
PCR Forward primer TCACAGTCACCCGTCAGGTA
Reverse primer TAACATTGAGCTGCACCGAA
Product size 335
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |