Cherry SNP DataBase

SNP information

Name Pav_sc0000975.1_80992R
Chr PAV_r1.0chr4
Pos (Chr) 13357452
PAV_r1.0 Pav_sc0000975.1
Pos (PAV_r1.0) 80992
REF G
ALT A
SSR motif
Gene Name Pav_sc0000975.1_g160.1.mk
Annotation PREDICTED: serine/threonine-protein kinase dst4
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1747-52C>T
Amino Acid
PCR Forward primer CAAGCGAATTTGCAACTGAA
Reverse primer GTGCTGCAAAAGCACACCTA
Product size 319
Enzymes for CAPS AfaI
Exp. fragment size (REF) 63,45,171,40
Exp. fragment size (ALT) 63,216,40
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |