Cherry SNP DataBase

SNP information

Name Pav_sc0000978.1_1602K
Chr PAV_r1.0chr1
Pos (Chr) 31079239
PAV_r1.0 Pav_sc0000978.1
Pos (PAV_r1.0) 1602
REF G
ALT T
SSR motif
Gene Name Pav_sc0000978.1_g010.1.mk
Annotation hypothetical protein PRUPE_ppa015459mg, partial
snpEff Effect synonymous_variant
Impact LOW
Codon c.3256C>A
Amino Acid p.Arg1086Arg
PCR Forward primer TTTTTATGTGCACGCTTTCG
Reverse primer AGAGCTGGTTCTTTGGGTGA
Product size 333
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |