Cherry SNP DataBase

SNP information

Name Pav_sc0000981.1_267950Y
Chr PAV_r1.0chr3
Pos (Chr) 7399412
PAV_r1.0 Pav_sc0000981.1
Pos (PAV_r1.0) 267950
REF T
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.267950T>C
Amino Acid
PCR Forward primer TTGCACCAAAGCATCAGACT
Reverse primer CTTCAGCAGCAGCAACAAAG
Product size 312
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |