Cherry SNP DataBase

SNP information

Name Pav_sc0000981.1_307497R
Chr PAV_r1.0chr3
Pos (Chr) 7438959
PAV_r1.0 Pav_sc0000981.1
Pos (PAV_r1.0) 307497
REF G
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.307497G>A
Amino Acid
PCR Forward primer ACCTTTGCCACATCTCTGCT
Reverse primer CTCGAAGGCCTACAACCAAA
Product size 338
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |