Cherry SNP DataBase

SNP information

Name Pav_sc0001003.1_146098K
Chr PAV_r1.0chr4
Pos (Chr) 8627477
PAV_r1.0 Pav_sc0001003.1
Pos (PAV_r1.0) 146098
REF G
ALT T
SSR motif
Gene Name Pav_sc0001003.1_g260.1.mk
Annotation PREDICTED: LRR receptor-like serine/threonine-protein kinase GSO1
snpEff Effect synonymous_variant
Impact LOW
Codon c.1248C>A
Amino Acid p.Gly416Gly
PCR Forward primer AATCTCAAGCTTCCCAAGCA
Reverse primer TCAGATGCTGCAATTTTTGG
Product size 279
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/ALT ALT/ALT ALT/ALT REF/REF REF/ALT


| Top |