Cherry SNP DataBase

SNP information

Name Pav_sc0001003.1_146373S
Chr PAV_r1.0chr4
Pos (Chr) 8627202
PAV_r1.0 Pav_sc0001003.1
Pos (PAV_r1.0) 146373
REF C
ALT G
SSR motif
Gene Name Pav_sc0001003.1_g260.1.mk
Annotation PREDICTED: LRR receptor-like serine/threonine-protein kinase GSO1
snpEff Effect missense_variant
Impact MODERATE
Codon c.973G>C
Amino Acid p.Val325Leu
PCR Forward primer CCCCCAACTCATAAAGCTCA
Reverse primer TCGAAGGTCCAATACCCAAG
Product size 330
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/ALT ALT/ALT ALT/ALT REF/REF REF/ALT


| Top |