Cherry SNP DataBase

SNP information

Name Pav_sc0001009.1_84771S
Chr PAV_r1.0chr8
Pos (Chr) 12723568
PAV_r1.0 Pav_sc0001009.1
Pos (PAV_r1.0) 84771
REF C
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.84771C>G
Amino Acid
PCR Forward primer CCAAATGGTCCACCACTACC
Reverse primer TGAAGTTTGGATGAGGACCC
Product size 288
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT REF/REF REF/ALT REF/REF REF/ALT


| Top |