Cherry SNP DataBase

SNP information

Name Pav_sc0001015.1_40093R
Chr PAV_r1.0chr1
Pos (Chr) 34861552
PAV_r1.0 Pav_sc0001015.1
Pos (PAV_r1.0) 40093
REF G
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.40093G>A
Amino Acid
PCR Forward primer GAAACTGAACTGAACGAAATCAA
Reverse primer CAAGTTGCCAACCCACTCTT
Product size 335
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT ALT/ALT ALT/ALT ALT/ALT REF/REF ALT/ALT REF/ALT


| Top |