Cherry SNP DataBase

SNP information

Name Pav_sc0001025.1_181458R
Chr PAV_r1.0chr8
Pos (Chr) 2586899
PAV_r1.0 Pav_sc0001025.1
Pos (PAV_r1.0) 181458
REF G
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.181458G>A
Amino Acid
PCR Forward primer CTCGATTGTCAACGCATAGC
Reverse primer TTCAGCTCATTCGATTTCTTCA
Product size 297
Enzymes for CAPS AfaI
Exp. fragment size (REF) 105,33,52,107
Exp. fragment size (ALT) 105,33,159
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |