Cherry SNP DataBase

SNP information

Name Pav_sc0001046.1_305907R
Chr PAV_r1.0chr2
Pos (Chr) 17666824
PAV_r1.0 Pav_sc0001046.1
Pos (PAV_r1.0) 305907
REF A
ALT G
SSR motif
Gene Name Pav_sc0001046.1_g500.1.mk
Annotation PREDICTED: soluble inorganic pyrophosphatase
snpEff Effect intron_variant
Impact MODIFIER
Codon c.777+32A>G
Amino Acid
PCR Forward primer TGGCATGATCTTGAAATTGG
Reverse primer TTTGACTTTGCTTCCCTTGG
Product size 310
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |