Cherry SNP DataBase

SNP information

Name Pav_sc0001077.1_44840R
Chr PAV_r1.0chr3
Pos (Chr) 15831623
PAV_r1.0 Pav_sc0001077.1
Pos (PAV_r1.0) 44840
REF G
ALT A
SSR motif
Gene Name Pav_sc0001077.1_g050.1.mk
Annotation PREDICTED: probable beta-1,3-galactosyltransferase 2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1076-89G>A
Amino Acid
PCR Forward primer GTTACCCCTTAGTGGACCCC
Reverse primer CACTCCACAAAGCGTTCTCA
Product size 297
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT


| Top |