Cherry SNP DataBase

SNP information

Name Pav_sc0001077.1_55912R
Chr PAV_r1.0chr3
Pos (Chr) 15820551
PAV_r1.0 Pav_sc0001077.1
Pos (PAV_r1.0) 55912
REF A
ALT G
SSR motif
Gene Name Pav_sc0001077.1_g070.1.br
Annotation PREDICTED: tripartite motif-containing protein 44-like
snpEff Effect synonymous_variant
Impact LOW
Codon c.210T>C
Amino Acid p.Asp70Asp
PCR Forward primer ACATTGTCTTTGTGGTGGCA
Reverse primer GAACCCTATCATGAACCCGA
Product size 278
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT


| Top |