Cherry SNP DataBase

SNP information

Name Pav_sc0001077.1_56016S
Chr PAV_r1.0chr3
Pos (Chr) 15820447
PAV_r1.0 Pav_sc0001077.1
Pos (PAV_r1.0) 56016
REF C
ALT G
SSR motif
Gene Name Pav_sc0001077.1_g070.1.br
Annotation PREDICTED: tripartite motif-containing protein 44-like
snpEff Effect missense_variant
Impact MODERATE
Codon c.106G>C
Amino Acid p.Glu36Gln
PCR Forward primer TCCTAATGCTGCTGCTGATG
Reverse primer TTTGATGAACTTGCCACCTG
Product size 306
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT


| Top |