Cherry SNP DataBase

SNP information

Name Pav_sc0001077.1_94139Y
Chr PAV_r1.0chr3
Pos (Chr) 15782324
PAV_r1.0 Pav_sc0001077.1
Pos (PAV_r1.0) 94139
REF C
ALT T
SSR motif
Gene Name Pav_sc0001077.1_g150.1.mk
Annotation PREDICTED: 5'-adenylylsulfate reductase 1, chloroplastic-like
snpEff Effect synonymous_variant
Impact LOW
Codon c.180C>T
Amino Acid p.His60His
PCR Forward primer CAGTGGAGCTGAGGATGTCA
Reverse primer CATGGCTTGAATGTTGCAGT
Product size 304
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/ALT REF/ALT REF/ALT REF/REF


| Top |