Cherry SNP DataBase

SNP information

Name Pav_sc0001080.1_380093S
Chr PAV_r1.0chr3
Pos (Chr) 22023789
PAV_r1.0 Pav_sc0001080.1
Pos (PAV_r1.0) 380093
REF G
ALT C
SSR motif
Gene Name Pav_sc0001080.1_g540.1.mk
Annotation PREDICTED: uncharacterized protein LOC103330287
snpEff Effect missense_variant
Impact MODERATE
Codon c.918C>G
Amino Acid p.Phe306Leu
PCR Forward primer GGACCCTTGGGACAAAGAAT
Reverse primer AATGCAAAATCCCAGAGTGG
Product size 339
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT REF/REF ALT/ALT ALT/ALT REF/ALT


| Top |