Cherry SNP DataBase

SNP information

Name Pav_sc0001080.1_652343Y
Chr PAV_r1.0chr3
Pos (Chr) 21751539
PAV_r1.0 Pav_sc0001080.1
Pos (PAV_r1.0) 652343
REF C
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.652343C>T
Amino Acid
PCR Forward primer AAGGCCTTGTTTGAGCTTGA
Reverse primer TCTTTCCCTTGTTGTGAGGG
Product size 341
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF ALT/ALT REF/REF REF/REF


| Top |