Cherry SNP DataBase

SNP information

Name Pav_sc0001080.1_662601R
Chr PAV_r1.0chr3
Pos (Chr) 21741281
PAV_r1.0 Pav_sc0001080.1
Pos (PAV_r1.0) 662601
REF A
ALT G
SSR motif
Gene Name Pav_sc0001080.1_g1210.1.mk
Annotation PREDICTED: triacylglycerol lipase 2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.292-316T>C
Amino Acid
PCR Forward primer GGGTTCTTTTTGCCTCATCA
Reverse primer TGGATGCTAGAATTACGCCC
Product size 301
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT REF/REF ALT/ALT ALT/ALT REF/ALT


| Top |