Cherry SNP DataBase

SNP information

Name Pav_sc0001082.1_6841R
Chr PAV_r1.0chr1
Pos (Chr) 10219664
PAV_r1.0 Pav_sc0001082.1
Pos (PAV_r1.0) 6841
REF A
ALT G
SSR motif
Gene Name Pav_sc0001082.1_g020.1.br
Annotation sugar transport protein 13
snpEff Effect synonymous_variant
Impact LOW
Codon c.372T>C
Amino Acid p.Ser124Ser
PCR Forward primer AGCTGGCAAGCATAAGCAAT
Reverse primer TCCTTGTACCTCGCTGCTTT
Product size 278
Enzymes for CAPS AluI
Exp. fragment size (REF) 2,149,58,69
Exp. fragment size (ALT) 2,149,15,43,69
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT ALT/ALT REF/REF ALT/ALT REF/ALT


| Top |