Cherry SNP DataBase

SNP information

Name Pav_sc0001082.1_80105M
Chr PAV_r1.0chr1
Pos (Chr) 10292928
PAV_r1.0 Pav_sc0001082.1
Pos (PAV_r1.0) 80105
REF C
ALT A
SSR motif
Gene Name Pav_sc0001082.1_g130.1.mk
Annotation PREDICTED: F-box/kelch-repeat protein At1g57790-like
snpEff Effect missense_variant
Impact MODERATE
Codon c.681C>A
Amino Acid p.Asn227Lys
PCR Forward primer CTGACGTCCCCAGATTGTTT
Reverse primer CTGCAAGGCTTCGTAACTCC
Product size 277
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |