Cherry SNP DataBase

SNP information

Name Pav_sc0001102.1_176492Y
Chr PAV_r1.0chr2
Pos (Chr) 22432057
PAV_r1.0 Pav_sc0001102.1
Pos (PAV_r1.0) 176492
REF T
ALT C
SSR motif
Gene Name Pav_sc0001102.1_g340.1.mk
Annotation PREDICTED: ceramide kinase
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1628+165A>G
Amino Acid
PCR Forward primer TAAGCTGGCGAAGGGAGTTA
Reverse primer TCCCCTGACATAGTTTCCCA
Product size 328
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |