Cherry SNP DataBase

SNP information

Name Pav_sc0001102.1_232006S
Chr PAV_r1.0chr2
Pos (Chr) 22487571
PAV_r1.0 Pav_sc0001102.1
Pos (PAV_r1.0) 232006
REF G
ALT C
SSR motif
Gene Name Pav_sc0001102.1_g500.1.mk
Annotation PREDICTED: probable disease resistance RPP8-like protein 2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.324+84C>G
Amino Acid
PCR Forward primer GGATTTTTGTCAAGACGGGA
Reverse primer CTCCGAAAGTTGGGATTGAA
Product size 260
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |