Cherry SNP DataBase

SNP information

Name Pav_sc0001102.1_317295Y
Chr PAV_r1.0chr2
Pos (Chr) 22572860
PAV_r1.0 Pav_sc0001102.1
Pos (PAV_r1.0) 317295
REF T
ALT C
SSR motif
Gene Name Pav_sc0001102.1_g640.1.mk
Annotation PREDICTED: putative nitric oxide synthase
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1165-30A>G
Amino Acid
PCR Forward primer GTCATTCCCTGCTGTTCCAT
Reverse primer GCAGCAGTGGTTCATTCAGA
Product size 221
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |