Cherry SNP DataBase

SNP information

Name Pav_sc0001102.1_549873Y
Chr PAV_r1.0chr2
Pos (Chr) 22805438
PAV_r1.0 Pav_sc0001102.1
Pos (PAV_r1.0) 549873
REF T
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.549873T>C
Amino Acid
PCR Forward primer TTAAACGGTATAGCCGCCC
Reverse primer TTATTGCCCCAAAAATGGAA
Product size 227
Enzymes for CAPS HaeIII
Exp. fragment size (REF) 227
Exp. fragment size (ALT) 69,158
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |