Cherry SNP DataBase

SNP information

Name Pav_sc0001124.1_161021K
Chr PAV_r1.0chr3
Pos (Chr) 239792
PAV_r1.0 Pav_sc0001124.1
Pos (PAV_r1.0) 161021
REF T
ALT G
SSR motif
Gene Name Pav_sc0001124.1_g260.1.mk
Annotation PREDICTED: uncharacterized aarF domain-containing protein kinase 1 isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.*44+440T>G
Amino Acid
PCR Forward primer GCAACCTGTGTATGCTGACC
Reverse primer CCCCATAACGCTCTTCCACT
Product size 350
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |